During cDNA amplification, 0.2 μM each of ADT (
Post cDNA cleanup, a 0.6x SPRI cleanup was performed, where larger cDNA fragments were kept on the beads, and the smaller tag libraries were retained in the supernatant. From the material retained on the beads, a portion of the eluted material was used to generate TCR α/β libraries (as written in the 10x protocol), BCR libraries (as written in the 10x protocol) and TCR γ/δ libraries (as written in the 10x protocol for TCR α/β, with these modifications):
5 μL of cDNA was taken into the initial reaction
For the first PCR, instead of the TCR1 primer mix provided by 10x genomics, we substituted our own mix consisting of primers 5′AGCTTGACAGCATTGTACTTCC and 5′TGTGTCGTTAGTCTTCATGGTGTTCC
For the second PCR, instead of the TCR2 primer mix provided by 10x Genomics, we substituted our own of primers consisting of 5′TCCTTCACCAGACAAGCGAC and 5′GATCCCAGAATCGTGTTGCTC
The 0.6X SPRI supernatant remaining following cDNA cleanup was subjected to 2 rounds of 2x SPRI. The eluate was split into three reactions for tag library production:
Hashtag libraries were created by performing a PCR reaction consisting of Kapa Hifi Master Mix, 10 μM 10x Genomics SI-PCR primer, and 10 μM Illumina TruSeq DNA D7xx primer.
Antibody libraries (for homemade conjugates) were created by performing a PCR reaction with Kapa Hifi Master Mix, 10 μM 10x Genomics SI-PCR primer, and 10 μM TruSeq Small RNA RPIx primer.
TotlaSeq-C antibody libraries were created by performing a PCR reaction with 2x Kapa Hifi Master Mix, 10 μM 10x Genomics SI-PCR primer, and 10 μM Nextera indexing primer (CAAGCAGAAGACGGCATACGAGATxxxxxxxxGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG).
