ChIP–qPCR was performed from neural progenitor cells (NPCs) as previously described (Bovio et al, 2019 (link); Ferrari et al, 2020 (link)), with minor changes in composition of buffers: Lysis buffer for EZH2 (10 mM EDTA; 50 mM TRIS–HCl pH 8; 0.2% sodium dodecyl sulphate (SDS) and 1× protease inhibitor), lysis buffer for H3K27me3 (10 mM EDTA; 50 mM TRIS–HCl pH 8; 1% SDS and 1× protease inhibitor), dilution buffer (20 mM TRIS–HCl; 2 mM EDTA; 150 mM NaCl and 1% Triton). All ChIP–qPCR experiments performed with NPCs were generated from V6.5 mESCs as described (Ferrari et al, 2020 (link)), cultured on 1 × 10 cm cell culture dishes and treated for 48 h with 10 μM EPZ or 0.1% DMSO as control. Approximately 6 million cells were used in each ChIP experiment. 3 μg of IgG (#2027, Santa Cruz), 5 μg of H3K27me3 (#39155, Active Motif, USA), 5 μg of EZH2 (#39901, Active Motif) or 3 μg of DOT1L (#77087, Cell Signaling) antibody was used. Significant differences in H3K27me3 and EZH2 binding to the selected locus were calculated between EPZ and control using a one‐sided paired Wilcoxon statistical test. Results from NPC ChIP–qPCR experiments are from a minimum of five independent replicates. The following primers targeting the transcriptional start site (TSS) on Asns were used:
ASNS_TSS_fw: TCCCGCTTACCTGAGCACTA
ASNS_TSS_rv: CAGCCACATGATGAAACTTCC
