To confirm the CPSF overexpression in the selected transfectants, RNA was extracted as previously described14 (link) and converted to complementary DNA (cDNA) using SuperScript reverse transcriptase (Invitrogen). Quantitative PCR reactions were performed in triplicate on the C1000 Touch Bio-Rad CFX96 real-time PCR detection system for CPSF using primer sets CPSF-1 (5’-TGAAACAGCAGCATGCCAAC-3’ and 5’-CGCGTCTGTCTACCATCAGA-3’) and CPSF-2 (5’-CGGCTCATTCTGATGGTAGACA-3’ and 5’-TGTGCGTTGCACACTGAATG-3’) in both control and CPSF overexpressing parasites. The expression level was normalized to tubulin and amplified using primers ‘AAGTGCGGCATCAACTACCA’ and ‘ACCCTCCTCCATACCCTCA’.
CPSF3 Overexpression in Trypanosoma Parasites
To confirm the CPSF overexpression in the selected transfectants, RNA was extracted as previously described14 (link) and converted to complementary DNA (cDNA) using SuperScript reverse transcriptase (Invitrogen). Quantitative PCR reactions were performed in triplicate on the C1000 Touch Bio-Rad CFX96 real-time PCR detection system for CPSF using primer sets CPSF-1 (5’-TGAAACAGCAGCATGCCAAC-3’ and 5’-CGCGTCTGTCTACCATCAGA-3’) and CPSF-2 (5’-CGGCTCATTCTGATGGTAGACA-3’ and 5’-TGTGCGTTGCACACTGAATG-3’) in both control and CPSF overexpressing parasites. The expression level was normalized to tubulin and amplified using primers ‘AAGTGCGGCATCAACTACCA’ and ‘ACCCTCCTCCATACCCTCA’.
Corresponding Organization :
Other organizations : University of Georgia, Texas A&M University, The University of Texas MD Anderson Cancer Center, University of Kansas, Pfizer (United States)
Variable analysis
- Overexpression of the CPSF gene
- Expression level of the CPSF gene
- Tubulin expression level
- Positive control: Control parasites without CPSF overexpression
- Negative control: Not mentioned
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!