The extraction of RNA from venous blood was carried out using PAXgeneTM Blood RNA kit (Qiagen, Hilden, Germany), and all extraction steps were performed according to the instructions attached to the kit. The extraction of total RNA from the cells was performed using TRIzol reagent (Thermo Fisher Scientific) method. The extracted total RNA was washed with 75% ethanol and dissolved in DEPC water. NanoDrop™ 2000/2000c spectrophotometer was used to detect the concentration of RNA (DEPC water was used as a negative control). 5 μg of total RNA was reverse transcribed to cDNA using a Superscript III transcriptase kit (Invitrogen, 18080093). The quantification of cDNA was performed on the 7500 Real Time PCR System (Applied Biosystems/Life Technologies, Carlsbad, CA, USA) using SYBR premix EX TAQ II kit (Takara, Dalian, China). Experimental results were analyzed using the 2-ΔΔCt method. GAPDH was used as the internal reference gene.44 (link)
 The primers were synthesized by Sangon Biotechnology Co, Ltd (Shanghai, China) as below: miR-485-5p (F: 5′-ACTTGGAGAGAGGCTGGC-3′, R: 5′- AAAAGAGAGGAGAGCCGTGT -3′; YAP1 (F: 5′-TTTTACCGCGTCTCCCTG
ATT -3′, R: 5′-AGAAACACCTGGGCTAGTAGAAA-3′); GAPDH (F: 5′-GACAGT
CAGCCGCATCTTCT-3′, R: 5′-GCGCCCAATACGACCAAATC-3′).