Quantitative Analysis of Immune Mediators in TAMs and MDMs

Total RNA from TAMs was extracted with TRIfast (Peqlab, no. 30-2020) or from MDMs with the NucleoSpin RNA kit (Macherey&Nagel, no. 740955) according to the manufacturer’s instructions. Complementary DNA synthesis was carried out with the iScript cDNA Synthesis Kit (Bio-Rad, no. 170-8891SP) according to the manufacturer’s instructions with 250–500 ng of purified RNA per sample. Quantitative PCR analyses were performed in three technical replicates per sample using ABsolute SYBR Green master mix (Thermo Scientific, no. AB-1158B) in Mx3000p and Mx3005 thermocyclers (Stratagene). The ribosomal protein 27, large subunit (RPL27) transcript was chosen for normalization after testing three housekeeping genes selected from our RNA-seq datasets with eight different TAM samples. RT-qPCR was carried out using the following primers: RPL27, AAAGCTGTCATCGTGAAGAAC and GCTGTCACTTTGCGGGGGTAG; IL12B, GCGAGGTTCTAAGCCATTCG and ACTCCTTGTTGTCCCCTCTG; CXCL10, AAGCAGTTAGCAAGGAAAGGTC and GACATATACTCCATGTAGGGAAGTGA. Raw data were evaluated with the Cy0 method (48 (link)) or the MxPro 4.01 software from Stratagene for Ct value calculation as indicated.