Using a CRISPR/Cas-9 approach, as we have previously described23 (link), we generated a Parkin knockout (KO) HEK293T cell line. In brief, HEK293T cells were transiently transfected with two gRNA-Cas9 plasmids (px459, Addgene 62988), each encoding a sgRNA-targeting exon one of PARK2 gene;
sgRNA1: CTCCAGCCATGGTTTCCCAG and sgRNA2: CTGCGAAAATCACACGCAAC.
After 48 h, puromycin is added for selection of transfected cells. Clonal cell lines were isolated by serial dilution to isolate single cells per well in a 96 well dish. Each colony was screened for shorter fragment with primers external to exon 1, F:AAGGGCTTCGAGTGATGCTC, R: CCTTGCTGCTCCTGTAGTCA. Confirmation of genetic knockout was confirmed by Sanger sequencing. The wild-type (WT) HEK293T cell line was used as a control for comparison. HEK293T cells were maintained at 37 °C and 5% CO2 in DMEM (Life Technologies) supplemented with 10% FBS (Life Technologies), and 1% penicillin/streptomycin (Life Technologies).
Free full text: Click here