Quantitative expression analysis of GAPDH and cel-miR-39-3p

The levels of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) transcripts and of cel-miR-39-3p in samples were evaluated using reverse transcription quantitative real-time PCR (qPCR). More in detail, the same quantity of each sample was reverse transcribed using GoScript Reverse Kit (Promega) and GAPDH transcript levels were subsequently amplified with StepOne system (Applied Biosystems), using Syber Green master mix (GoTaq qPCR Master Mix Kit, Promega) and specific primer pairs (forward primer: AACTTTGGTATCGTGGAAGGA; reverse primer: GGCAGTGATGGCATGGAC) (Barba et al., 2012 (link); Di Pietro et al., 2017 (link)). In parallel, total RNAs were also used as templates for miRNA reverse transcription, using TaqMan^TM Advanced miRNA cDNA Synthesis Kit (ThermoFisher), according to the manufacturer’s instructions. cel-miR-39-3p levels were amplified using TaqMan^TM Fast Advanced Master Mix (ThermoFisher) and a specific TaqMan^TM Advanced miRNA Assay (Assay ID#478293_mir, ThermoFisher).

Free full text: Click here

Palmieri V., Di Pietro L., Perini G., Barba M., Parolini O., De Spirito M., Lattanzi W, & Papi M. (2020). Graphene Oxide Nano-Concentrators Selectively Modulate RNA Trapping According to Metal Cations in Solution. Frontiers in Bioengineering and Biotechnology, 8, 421.

Publication 2020

GoScript Reverse Kit StepOne system GoTaq qPCR Master Mix Kit TaqManTM Advanced miRNA cDNA Synthesis Kit TaqManTM Fast Advanced Master Mix TaqManTM Advanced miRNA Assay

Assay Cdna Gapdh Glyceraldehyde 3 phosphate dehydrogenase Mirna Primer Promega Quantitative real time pcr Reverse transcription Rnas Synthesis

Corresponding Organization : Agostino Gemelli University Polyclinic

Top 5 similar protocols

Variable analysis

independent variables

None explicitly mentioned

dependent variables

Levels of GAPDH transcripts
Levels of cel-miR-39-3p

control variables

Same quantity of each sample used for reverse transcription
Use of specific primer pairs for GAPDH transcript amplification
Use of Taqman Advanced miRNA Assay for cel-miR-39-3p amplification

controls

Positive control: Not explicitly mentioned
Negative control: Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!