DNA Polymerase Assay with Replication Factors

DNA polymerase assays were performed as described previously (46 (link)). The standard reaction mixture (25 μl) contained 20 mM HEPES–NaOH (pH 7.5); 50 mM NaCl; 0.2 mg/ml BSA; 1 mM DTT; 10 mM MgCl₂; 1 mM ATP; 0.1 mM each of dGTP, dATP, dTTP, and [α-³²P]dCTP; 33 fmol (240 pmol for nucleotides) of singly primed ss M13mp18 DNA with the 36-mer primer CAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGG; RPA (9.1 pmol); PCNA (1.0 pmol trimer); RFC (0.26 pmol); polymerase δ (pol δ; 0.38 pmol); E1 (0.85 pmol); MMS2-UBC13 (16 pmol); RAD6-(RAD18)₂ (0.62 pmol); ubiquitin (174 pmol); and the indicated amounts of HLTF. Reaction mixtures lacking pol δ were preincubated at 30°C for 1 min, and reactions were started by addition of pol δ. After incubation at 30°C for 10 min, reactions were terminated with 2 μl of 300 mM EDTA, and the mixtures were immediately chilled on ice. Samples (5 μl) were spotted on DE81 paper (Whatman), which was washed three times with 0.5 M Na₂HPO₄. The amount of incorporated [α-³²P]dCMP into DNA was determined as the radioactivity retained on the paper. For electrophoretic analysis of replication products, 5 μl samples were mixed with 1 μl of loading buffer (150 mM NaOH/10 mM EDTA/6% sucrose/0.1% bromophenol blue) and electrophoresed on 0.7% alkaline–agarose gels as described previously (50 (link)).