Engineered Lnc-RPS6P3 Aptamer and shRNA

The full-length sequence of human lnc-RPS6P3 was cloned into the pLentiLox3.7 plasmid. To generate pLL3.7-lnc-RPS6P3-S1, the S1 aptamer sequence containing a 44-nt (5′-ACCGACCAGAATCATGCAAGTGCGTAAGATAGTCGCGGGCCGGG-3′) was inserted into the 3′-end of lnc-RPS6P3. The short hairpin RNA (shRNA) targeting lnc-RPS6P3 was constructed into pSIH-H1-GFP lentiviral vector. The shRNA target sequences were as follows: shRNA-lnc-RPS6P3#1, GCGTATTGCTCTGAAGAAACA; shRNA-lnc-RPS6P3#2, GGCGTATTGCTCTGAAGAAAC.
Mouse anti-M1, anti-PB1, anti-PB2, anti-PA and rabbit anti-NP antibodies were kindly provided by Prof. Wenjun Liu. Mouse anti-β-actin (KM9001), anti-GAPDH (KM9002) antibodies were purchased from Sungene Biotech Co. (Tianjin, China). Mouse anti-Flag antibody (F3165) was purchased from Sigma (Kawasaki, Japan). Mouse anti-Myc antibody (sc-40) was purchased from Santa Cruz (Dallas, TX, USA). HRP-conjugated secondary antibodies (115-035-003 (anti-mouse IgG) or 111-035-003 (anti-rabbit IgG)) were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). Rabbit anti-RIG-I antibody (3743S) was purchased from Cell Signaling Technology (Danvers, MA, USA).
The protein-coding potential of lnc-RPS6P3 was analyzed using the Coding Potential Calculator (CPC2.0) software (http://cpc2.gao-lab.org/index.php) accessed on 5 June 2022 [30 (link)].