Chromatin Immunoprecipitation of Notch3 Targets in MDAMB-231 Cells
In all, 40 × 106 MDAMB-231 cells were seeded 24 h before treatment or not with 1 μg/mL of doxycycline to induce the intracellular domain of Notch3 (N3ICD). Cells were scraped, centrifuged at 800 × g for 5 min and washed with 20 mL of cold PBS before fixation in 20 mL of paraformaldehyde (PFA) for 10 min at 4 °C. Cells were washed three times with cold PBS, resuspended in 9 mL of L1 buffer (50 mM Tris pH 8.0, 2 mM EDTA, 0.1% NP40, 10% Glycerol) for 5 min on ice. Cells were centrifuged at 2000 × g at 4 °C for 5 min and the pellet resuspended in 2 mL of L2 buffer (50 mM Tris pH 8, 5 mM EDTA, 1% SDS). The chromatin fragmentation was done by sonication at 20%, for 6 min with 1 s between each pulse then the debris were removed by centrifugation at 9400 × g for 5 min. DNA concentration was assessed by collecting 150 μL of fragmented DNA and mixing it with 2 μL of proteinase (10 mg/mL) and 6 μL of NacL (5 mM) for 30 min at 37 °C. Then, 2 μL of proteinase K (20 mg/mL) was added and incubated at 65 °C for 2 h. DNA was purified with NucleoSpin Gel and PCR clean-up (MN 740609.5), and 10 μg of DNA was diluted in 9 volumes of dilution buffer (20 mM Tris pH 8.0, 2 mM EDTA, 0.1% SDS, 1% NP40, 500 mM Nacl). 100 μL served as input. A pre-clear was conducted by adding of 30 μL of chip-Grade Protein G Magnetic Beads (Cell signaling) for 3 h at 4 °C. The supernatant was collected and 2 μg of antibody HeyL or HA (sigma-aldrich) was added and incubated overnight at 4 °C. To collect the immunocomplexes, 30 μL of beads were supplemented to the mix DNA/antibody and incubated for 30 min at 4 °C then centrifuge at 3400 × g for 1 min. Immunocomplexes were washed three times for 5 min with washing buffer (20 mM Tris pH 8.0, 2 mM EDTA, 0.1% SDS, 1% NP40, 500 mM NaCl) and three times with 1x TE buffer. The Ag/Ab complexes were extracted in 100 μL of elution buffer (1x TE buffer, 2% SDS) and reversion of crosslinking was done with proteinase A, NaCl and proteinase K then DNA purified with Nucleospin Gel and PCR clean-up. A q-PCR was then performed on input and Chip using the following primers: MYBL2.1prom-F: AGGAGAGGAAGCAGGGAGAG MYBL2.1prom-R: CATAGCGAAGACCGAGGAAG MYBL2.2prom-F: TTTTGTCTCCCGCCTAATTG MYBL2.2prom-R: CCGGAATGTTAAGGAGCAAA HEYLprom-F: GCTCTCATGCAGCTTCCTTT HEYLprom-R: GGCAACCCATCAAACTGTTC HEYLprom4F: CATTACTGCATCTTCCCCGC HEYLprom4R: AGACGTTGGCTCTGAGTTGA HEYLprom5F: ACATACCCCAACTCTGCTCC HEYLprom5R: TTGGCTCGCAACAAATCCAA HEYLprom6F: CAAGACCCCACTGTGATCCT HEYLprom6R: GCTGGGGTTGTTGTGTCTTT HEYLprom7F: TAGTCAGTGAGAGGGTGGGT HEYLprom7R: ACATAGTGTCTGCCTCGCTT
Brahim S., Negulescu A.M., Geneste C., Schott T., Lin S., Morel L.O., Rama N., Gadot N., Treilleux I., Mehlen P, & Meurette O. (2023). Notch3 regulates Mybl2 via HeyL to limit proliferation and tumor initiation in breast cancer. Cell Death & Disease, 14(2), 171.
Publication 2023
Antibody BufferCellsCentrifugation ChipChromatin Cold DilutionDoxycycline Edta G 800 Glycerol Heyl Intracellular Nacl Notch3 Paraformaldehyde Primers Protein chip Proteinase Proteinase a Proteinase k Pulse Tris
Corresponding Organization :
Other organizations :
Centre de Recherche en Cancérologie de Lyon, Université Libre de Bruxelles, Centre Léon Bérard
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to
get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required