CRISPR/Cas9 Correction of TH R233H Mutation

For correcting the R233H mutation, THDA1#17 mutant iPSCs were edited using CRISPR/Cas9. Three CRISPR/Cas9 gRNAs targeting the p.Arg233His mutation site in the TH gene were designed together with an ssODN (SIGMA) carrying the wild‐type allele and two additional synonymous mutations to eliminate the PAM sequence and to introduce a de novo HindIII to help with the molecular screening (GGGTCCCGAGCGCAGGGGCCCCTCACTGCCTGTACTGGAAGGCGATCTCAGCAATAAGCTTTCTGCGCTGGCGGTACACCTGGTCCGAGAAGCCCTGAGGG). The T7 endonuclease I assay (New England Biolabs) was performed to assess which gRNA had the highest cleavage efficiency. The best performing gRNA (TH_ex6_gRNA1: ACCAGGTGTACCGCCAGCAC) was kindly provided by Synthego.
The selected iPSC line (THDA1#17) was seeded at a density of 300,000 cells per well of a six‐well plate. The next day, iPSCs were nucleofected with a preassembled gRNA and Cas9 protein RNP complex (ThermoFisher Scientific) using the 4D AMAXA nucleofector (Lonza). Individual colonies were screened by PCR followed by HindIII digestion (ThermoFisher Scientific). Those clones with positive HindIII digestion were sequenced by Sanger sequencing. Clones showing bi‐allelic recombination and the desired genotype were expanded, cryopreserved, and karyotyped. The maintenance of the expression of the pluripotency marker and the ability to obtain the three germ layers was verified by immunofluorescence.