RAP1 Mutant Expression Constructs

Human RAP1A and RAP1B cDNA was cloned into the pK-FLAG plasmid or pEGFP-C3 plasmid (Clonetech), generating N-terminal tagged expression constructs. RAP1 G12V point mutations were introduced by site-directed mutagenesis (Agilent Technologies, 200521), using the following mutagenesis primers: RAP1A G12V for: CTAGTGGTCCTTGGTTCAGTAGGCGTTGGGAAGTCTGC, RAP1A G12V rev: GCAGACTTCCCAACGCCTACTGAACCAAGGACCACTAG, RAP1B G12V for: CTAGTCGTTCTTGGCTCAGTAGGCGTTGGAAAGTCTGC, RAP1B G12V rev: GCAGACTTTCCAACGCCTACTGAGCCAAGAACGACTAG. CFP_Gem_pcDNA4_HisMaxC was a gift from Henry Colecraft (Addgene plasmid # 41653^{50 (link)}) and was cloned into the pK-FLAG plasmid. Dominant-negative RagB T54N, RagA QL, Rag C SN, mTOR-au1, Rheb, Rictor and Raptor expression constructs have been described previously^{47 (link),51 (link)–53 (link)}. pLAMP1-mCherry was a gift from Amy Palmer (Addgene 45147^{54 (link)}) and TFEB-EGFP was kindly provided by Drs. Lewis Cantley and Mark Lundquist (Weill Cornell Medicine). mEGFP-Lifeact-7 was kindly provided by Michael Davidson (Addgene plasmid 54610). The mStrawberry-ATG4B-C74A construct^{30 (link)} was a kind gift from Drs. Fahad Benthani and Yan Feng (MSKCC).