Plasma miRNA Profiling Protocol

RNA was extracted from plasma samples using the miRNeasy Serum/Plasma Kit (Qiagen, Hilden, Germany) according to manufacturer’s protocol. The quantity and quality of RNA was determined by 260:280 ratio using NanoDrop Analyzer (Thermo Scientific, Waltham, MA, USA). Following RNA extraction, miRCURY LNA RT Kit (Qiagen, Hilden, Germany) was used for our RT reactions, to synthesize cDNA, with 50 ng of total RNA for each reaction, as described previously [109 (link),110 (link)]. To normalize the miRNA expression, an internal control, a synthetic spike-in, was used. Next, miRNA specific primers were used, combined with SYBR Green Master Mix at a final volume of 10 μL, to perform RT-PCR reactions in a 96-well plate. Three technical replicates were used per sample to ensure accuracy in the RT-PCR amplification data which was run on a 7500 Fast Real Time PCR System (Applied Biosystems, Foster City, CA, USA). The comparative threshold cycle (Ct) method was used to calculate the fold amplification as specified by the manufacturer. The following is the sequence of human miRNA primers used for our RT-PCR reactions: hsa-miR-122–3p: 5’AACGCCAUUAUCACACUAAAUA; hsa-miR-34a-3p: 5’CAAUCAGCAAGUAUACUGCCCU; has-miR-375–3p: 5’UUUGUUCGUUCGGCUCGCGUGA; hsa-miR-16–5p: 5’UAGCAGCACGUAAAUAUUGGCG; has-miR-21–3p: 5’CAACACCAGUCGAUGGGCUGU