Quantitative RT-PCR Analysis of Retinal Gene Expression

Gene expression analysis was performed using quantitative RT-PCR as previously described [32] (link). In brief, retinas were dissected rapidly after eye enucleation and placed in Trizol (Life Technologies, Carlsbad, CA) for RNA extraction. Eyes were consistently collected in the early afternoon for each animal in order to eliminate variability due to circadian expression. Two micrograms of total RNA was reverse transcribed using Retroscript (Ambion, Austin, TX). Real-time PCR was performed in technical triplicates with a minimum of three biological replicates using SYBR Green PCR master mix (Applied Biosystems, Warrington, UK). The following primer were used: Nr1d1 (F: CGGCTCAGCGTCATAATGAA, R: GTTGCCTTGCCGTAGACTGTT); Opn1sw (F: ACCTCTAACAATGGGCTGTGTGA, R: GCTGCCGAAGGGTTTACAGA); Gnat2 (F: CCAGCTGGACCGGATTACAG, R: CAGGTGACTCCCTCGAAGCA) and β-Actin (F: ATGCCTCCCCTACCAATCTTC, R: GGATAACGTCCAGGGAACCA). Reactions were quantified using a Roche 480 LightCycler real time PCR instrument. Relative expression levels were normalized to the amount of β-Actin expressed and fold change relative to wild-type C57BL/6J control was calculated using the delta Ct method. Standard error was calculated to determine statistical significance.