Chromatin Immunoprecipitation for NRF2 and POL2

Chromatin was isolated from cell pellets using the Magna ChIP G kit (17-611, Millipore, Burlington, MA) per protocol (Millipore). Sonication was performed using the Diagenode Bioruptor Plus for two sets of five 30 s cycles. DNA was quantified using a spectrophotometer, and 50 μg of chromatin was diluted to a total volume of 500 μL in dilution buffer. Antibodies used for immunoprecipitation included rabbit IgG (Millipore), anti-NRF2 (#12721, Cell Signaling Technology, Danvers, MA, USA), and anti-POL2 (05-952-I, Millipore, Burlington, MA, USA). Immunoprecipitations were incubated at 4 °C overnight. Enrichment of the IL-1β promoter was assessed by RT-PCR using SYBR green reagent (Qiagen) primers targeting the IL-1β promoter known to bind DNA polymerase II (POL2) (Fwd AGATGCTCTGGAAGGAAGCA; Rev GGCAGCTCCTGTCTTGTAGG) and NRF2 (F TGATGATGTTGGCAAAGGAA; R AAAAGCTAGAGTGCCCGTCA) [12 (link)]. Results were expressed as fold enrichment over IgG.