GW3965 was synthesized as previously described27 (link). LG268 was from Ligand Pharmaceuticals. Oxysterols were purchased from Sigma and used as described28 (link). Simvastatin sodium salt was from Calbiochem. Ligands were dissolved in dimethyl sulfoxide before use in cell culture. MeXis was amplified from RNA purified from GW3695-treated primary mouse peritoneal macrophages using KOD polymerase (Millipore), forward 5’GTCTGAAAAGGAAGTTGAAGAAGA3’ and reverse 5’ AAGGAATCTAGTAAATTTTAATACTAA3’ primers. Primers were designed to provide flanking attB sequences and a SacI site at the immediate 3’ end. For details of oligonucleotide sequences please see supplementary file number 12. The fragments were then cloned into pDONR221 using the Gateway system and the minimal SV40 polyadenylation sequence was inserted at the SacI site. ON-Targetplus siRNAs (Catalog number R-050345) were used with Dharmafect 4 reagent per the manufacturer’s recommendations for knockdown studies (Dharmacon). For gene expression analysis, RNA was isolated using TRIzol reagent (Invitrogen) and analyzed by real-time PCR using an Applied Biosystems 7900HT sequence detector or Applied Biosystems Quant Studio 6 Flex. Results are normalized to 36B4 or cyclophilin. The following antibodies were used for immunohistochemistry: CD68 (MCA1957GA, AbD) 1:400 with secondary antibody biotin-SP-conjugated AffiniPure goat anti-rat IgG (H+L) (Jackson Laboratories). Details of antibodies and full-length blots are provided in supplementary file 13 and 14. In brief, for immunoblot analysis, the following antibodies were used: ABCA1 (Novus) 1:1,000, and actin (Sigma) 1:10,000.. For ChIP analysis, we used the LXR antibody previously described29 (link); DDX17 antibody was generated by Douglas Black, UCLA30 (link). plentiCRISPR v2 was used for lentivrius production; the guide RNA was inserted into Bsmb1-digested plasmid and the plasmid was ligated with T4 DNA ligase. Guide insertions were verified via sequencing.For lentiviral overexpression studies, MeXis was cloned into the pSLIK-Zeo vector system 31 (link) and modified for lncRNA expression by replacement of the sequence between NcoI and MfeI sites in the pEN_TT entry vector with a minimal SV40 polyadenylation signal. The MeXis sequence was inserted into the NcoI site immediately upstream of the polyadenylation signal. Lentiviruses were packaged and purified as described 32 (link). For retroviral and adenoviral expression, the MeXis sequence was transferred from the pEN-TTpA entry vector to pBABE and pAd/CMV/V5-DEST, respectively, using the Gateway cloning system (Invitrogen Life Technologies).