Human proximal tubular epithelial (HKC-8) cells were cultured as previously described [7 (link)]. HKC-8 cells were stimulated with recombinant human TGF-β1 protein (R&D Systems, Minneapolis, MN) (5 ng/ml). To upregulate CXCR7 expression in HKC-8 cells, a plasmid encoding overexpressed CXCR7 was constructed by cloning the CXCR7 gene into the NotI and XhoI sites on the pcDNA3.1-3 x Flag-C vector. The CXCR7 cDNA was amplified using the following primers: forwards primer 5′-3′ GACGATGACAAGCTTGCGGCCGCCATGGATCTGCATCTCTTCGAC and reverse primer 5′-3′ GGTACCTCATCTAGACTCGAGTCATTTGGTGCTCTGCTCC. A control plasmid (pcDNA3) or CXCR7 expression plasmid (pFlag-CXCR7) was also transfected into HKC-8 cells using Lipofectamine 2000 (Life Technologies, Carlsbad, CA) according to the manufacturer’s instructions. After transfection for 24 h, the efficacy of the various treatments was determined by quantitative real-time PCR, Western blotting, and immunostaining.