Glycerol stocks of lentiviral shRNA targeting LDLR were obtained from Sigma-Aldrich (St. Louis, MO). shRNA sequences were: control shRNA: CAACAAGATGAAGAGCACCAA, and LDLR shRNA human (H1) GATGAAGTTGGCTGCGTTAAT, human (H2) GGGCGACAGATGCGAAAGAAA, mouse (M1) AGTCGCCATTCTCCCTTAATA, mouse (M2) ACGGGTTCAGATGTGAATTTG. Plasmid DNA generation, HEK293FT transfection, and target cell lentiviral transduction were performed as previously described [48 (link)]. After the transduction, puromycin was used for selection of stable knockdown of the LDLR in the tumor cells. LDLR protein reduction was confirmed by Western Blot analysis.
Protocol detail
LDLR Knockdown in Tumor Cells
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Cells
Glycerol
Human
Ldlr
Mouse
Plasmid
Protein
Puromycin
Shrna
Transfection
Tumor
Western blot analysis
Corresponding Organization : Icahn School of Medicine at Mount Sinai
Top 5 similar protocols
Variable analysis
independent variables
- ShRNA targeting LDLR
- Control shRNA
- Human (H1) LDLR shRNA
- Human (H2) LDLR shRNA
- Mouse (M1) LDLR shRNA
- Mouse (M2) LDLR shRNA
- LDLR protein reduction
- Glycerol stocks of lentiviral shRNA obtained from Sigma-Aldrich
- Plasmid DNA generation, HEK293FT transfection, and target cell lentiviral transduction performed as previously described [48]
- Puromycin used for selection of stable knockdown of the LDLR in the tumor cells
- Control shRNA
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!