Gene expression analysis in Drosophila under metal stress

After flies (3 to 4 d old) were exposed to fly media mixed with 10 mM CuSO₄, 10 mM ZnSO₄, or ddH₂O for 24 h, fly heads were collected using forceps and placed immediately into collection tubes kept cold in liquid nitrogen. Head tissues were then ground in 500 μL RLT lysis buffer (Qiagen) on ice. RNA was extracted with acid phenol and Direct-zol RNA microprep kits (Zymo Research) according to the manufacturer’s protocol. Complementary DNA was synthesized with EpiScript (Lucigen) and added to the iTaq Universal SYBR Green (Bio-Rad) system for qPCR. Target gene expression was normalized to the level of RP49 transcripts. Primers are provided below, with sequences adopted from refs. 84 (link)–86 (link, link):

RP49fwd (CCAAGCACTTCATCCGCCACC)

RP49rev (GCGGGTGCGCTTGTTCGATCC)

Gr33afwd (CCACCATCG CGGAAAATAC)

Gr33arev (ACACACTGTGGTCCAAACTC)

Gr66afwd (ACAGGAATCAG TCTGCACAA)

Gr66arev (AATGTTTCCATGTCCAGGGT)

Ir25afwd (CAATCCACTCAGCCATTCAA)

Ir25arev (ACCAGAGGCACTCCTTCAGA)

Ir76bfwd (CAGCGCAGCTTCGTCTACTA)

Ir76brev (CACAAAGTGCTTGTTCTTCG)

MtnAfwd (ACTGCGGATCTGACTGCAAG)

MtnArev (AAGATGCAGCGCCTCTACTC)

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Xiao S., Baik L.S., Shang X, & Carlson J.R. (2022). Meeting a threat of the Anthropocene: Taste avoidance of metal ions by Drosophila. Proceedings of the National Academy of Sciences of the United States of America, 119(25), e2204238119.

Publication 2022

RLT lysis buffer Direct-zol RNA microprep kits iTaq Universal SYBR Green

Acid phenol Buffer Cold Complementary dna Forceps Gene expression Head Nitrogen Primers Sybr green Tissues

Corresponding Organization :

Other organizations : Yale University

Top 5 similar protocols

Variable analysis

independent variables

10 mM CuSO4
10 mM ZnSO4
DdH2O

dependent variables

Target gene expression (Gr33a, Gr66a, Ir25a, Ir76b, MtnA) normalized to RP49 transcripts

control variables

Fly media
Fly age (3 to 4 days old)
Liquid nitrogen for head tissue collection
RLT lysis buffer for RNA extraction
Acid phenol and Direct-zol RNA microprep kits for RNA extraction
EpiScript for cDNA synthesis
ITaq Universal SYBR Green system for qPCR

controls

Positive control: Not specified
Negative control: Not specified

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!