Organs were fixed in 4% PFA (overnight, 4°C), washed in saline solution, dehydrated in solutions at increasing ethanol concentration from 70% to 100% (overnight, 4°C), and paraffin-embedded at 60°C after xylene soaking. The period of each step is determined according to the size of the processed sample.
Paraffin-embedded samples were sliced in 7 μm sections and analyzed. To perform the in situ hybridization, the sections were deparaffinized in xylene and rehydrated with EtOH 100% to EtOH 50%. After rehydration, the hybridization was performed as described in Fagman et al. [21 (link)], using a specific probe for Klhl14-AS amplified with Pwo SuperYield DNA Polymerase from adult mouse thyroid cDNA using the following oligos—Klhl14-AS sp6: GGCTGAACAGGAAGGGACCCT and Klhl14-AS T7: CAGATCACAGCTAAGAAAAAAGC.
PCR product was purified using the USB® PrepEase® Gel Extraction Kit (Affymetrix 78756). Digoxigenin-labelled riboprobes (sense and antisense) were obtained using the DIG-labeling RNA kit (Roche Diagnostics Basel, Switzerland) following the manufacturer's instructions. No signal was detected with the sense riboprobes (not shown). Images were obtained using an Axioskop microscope equipped with an Axiocam 105 color digital camera (Zeiss, Oberkochen, Germany). Images were processed using the Axion Vision software.
Paraffin-embedded samples were sliced in 7 μm sections and analyzed. To perform the in situ hybridization, the sections were deparaffinized in xylene and rehydrated with EtOH 100% to EtOH 50%. After rehydration, the hybridization was performed as described in Fagman et al. [21 (link)], using a specific probe for Klhl14-AS amplified with Pwo SuperYield DNA Polymerase from adult mouse thyroid cDNA using the following oligos—Klhl14-AS sp6: GGCTGAACAGGAAGGGACCCT and Klhl14-AS T7: CAGATCACAGCTAAGAAAAAAGC.
PCR product was purified using the USB® PrepEase® Gel Extraction Kit (Affymetrix 78756). Digoxigenin-labelled riboprobes (sense and antisense) were obtained using the DIG-labeling RNA kit (Roche Diagnostics Basel, Switzerland) following the manufacturer's instructions. No signal was detected with the sense riboprobes (not shown). Images were obtained using an Axioskop microscope equipped with an Axiocam 105 color digital camera (Zeiss, Oberkochen, Germany). Images were processed using the Axion Vision software.
Free full text: Click here
