16S rDNA Amplification and Sequencing

A colony of each isolate was cultured in tryptic soy broth incubated at 30 °C with 150 rpm agitation for 24 h. The DNA was extracted using the Fenol-Chloroform method [18 (link)]. The 16S rDNA was amplified using the PCR method with primers 1492R (TACGGYTACCTTGTTACGACT) 27F (GAGAGTTTGATCCTGGCTCA) [20 (link)]. The PCR products were purified with Charge Switch™ PCR Clean-Up Kit (Invitrogen™, Carlsbad, CA, USA) then sequenced and ran on the ABI 3730XL capillary DNA. A contiguous sequence was constructed with forward and reverse sequencing data resulting in a fragment of approximately 900 bp, with DNA Baser Sequence Assembler v4 (2013) (Heracle BioSoft, Arges, Romania).