Quantitative Analysis of HB9 Gene Expression

Cells were washed with PBS, and total RNA was extracted using Qiagen RNA Isolation Kit (Qiagen, Valencia, CA). Reverse transcription was performed using the High Capacity cDNA Reverse Transcription Kit (AB Applied Biosystems, Carlsbad, CA) according to the manufacturer’s instructions. Twenty ng of cDNA was used in the following PCR reaction using empirically determined conditions to allow a quantitative analysis [15] (link). PCR amplification was performing using REDTaq DNA Polymerase (Sigma) with a program of 95°C for 5 minutes, 35 cycles of 94°C for 30 seconds, 65°C for 1 minute, 72°C for 1 minute, an extension of 72°C for 5 minutes for Hb9 amplification; a program of 95°C for 5 minutes, 23 cycles of 94°C for 30 seconds, 60°C for 30 seconds, 72°C for 90 seconds, and an extension of 72°C for 5 minutes was used for GAPDH amplification. The following reverse and forward primers were utilized: HB9: AGCTGGGCCGGCACCTTCC and CCGCCGCCGCCCTTCTGTTTCTC; GAPDH: TGAAGGTCGGAGTCAACGGA and GATGGCATGGACTGTGGTCAT. PCR products were visualized on an ethidium bromide-stained1.5% agarose gel and the bend intensities under UV light were captured and analyzed with a Chemi-Imager 4400 v5.5 with the Alpha-Ease software. The HB9 expression levels were normalized to that of GAPDH.