Circulating miRNA Profiling in Cancer

From NanoString analysis, we selected candidate miRNAs that were significantly differential expression between cancerous and non-cancerous tissues. After filtering, the top 3 candidate miRNAs, including miR-223-3p, miR-199a-5p and miR-451a, were selected for validate their circulating expression levels by qRT-PCR analysis. Briefly, 200 μL of serum samples were extracted using a miRNA isolation kit (Cat No. RMI050, Geneaid Biotech, USA). For cDNA synthesis and poly (A) tail addition, the first-strand cDNA was then synthesized from purified total RNA using SL-poly (A) sequence: GTCGTATCCAGTGCAGGGTCCGAGGTAT TCGCACTGGATACGACAAAAAAAAAAAAAAAAAAVN and RevertAid First Strand cDNA Synthesis Kit (Cat No. 1622, Thermo Scientific, USA). The candidate miRNAs were assessed in duplicate by quantitative RT-PCR using SYBR Green system (QPCR Green Master Mix HRox, Cat No. BR0500402, Biotechrabbit, Germany) with specific primers including miR-223-3p:5’TGTCAGTTTGTCAAATACCCCA3’(forward),miR-199a5p:5’AGTGTTCAGAC TACCTGTTC3’(forward), miR-451a: 5’AAACCGTTACCATTACTGAGTT3’(forward) and SL-polyA-R: 5’GCAGGGTCCGAGGTATTCG3’ (universal reverse). MiR-21 was used as the internal control [12 (link)]. Downregulation was confirmed by StepOnePlus Real-time PCR System (Applied Biosystems, USA). The relative expression level was calculated by ΔΔCT of the 2^{- ΔΔCT} method [13 (link)].^.