Generation of TCF/Lef:H2B-GFP Transgenic Mice

To generate the pTCF/Lef:H2B-GFP construct, six copies of the TCF/Lef response elements together with the hsp68 minimal promoter from the TCF/Lef-LacZ reporter construct [11 (link)] were inserted into the AseI/Nhe1 sites of pCMV::H2B-GFP. Transgenic mice were generated by pronuclear injection following standard protocols. Animals were genotyped by PCR. Primers used for the PCR reaction were GFPGenotFW: ACAACAAGCGCTCGACCATCAC; GFPGenotRW: AGTCGATGCCCTTCAGCTCGAT. Two transgenic founder lines (TCF/Lef:H2B-GFP #16, TCF/Lef:H2B-GFP #61) were established both exhibiting similar patterns and levels of reporter expression. However, only one line (TCF/Lef:H2B-GFP #61) was further characterized in detail. Subsequent generations exhibited Mendelian transgene inheritance, stable transgene activity and comparable levels of reporter expression. Animals were maintained in accordance with National Institute of Health guidelines for the care and use of laboratory animals and under the approval of the Memorial Sloan-Kettering Cancer Center Institutional Animal Care and Use Committee.

Free full text: Click here

Ferrer-Vaquer A., Piliszek A., Tian G., Aho R.J., Dufort D, & Hadjantonakis A.K. (2010). A sensitive and bright single-cell resolution live imaging reporter of Wnt/ß-catenin signaling in the mouse. BMC Developmental Biology, 10, 121.

Publication 2010

Animals Cancer Inheritance Institutional animal care and use committee Laboratory animals Lacz Nhe1 Primers Response elements Transgene Transgenic Transgenic mice

Corresponding Organization :

Other organizations : Kettering University, McGill University

Top 5 similar protocols

Protocol cited in 49 other protocols

Variable analysis

independent variables

Generation of transgenic mice by pronuclear injection

dependent variables

Transgene expression pattern and levels
Transgene inheritance in subsequent generations

control variables

Maintenance of animals in accordance with National Institute of Health guidelines for the care and use of laboratory animals
Approval of the Memorial Sloan-Kettering Cancer Center Institutional Animal Care and Use Committee

controls

Positive control: TCF/Lef:H2B-GFP #16 transgenic founder line, which exhibited similar patterns and levels of reporter expression as the TCF/Lef:H2B-GFP #61 line
Negative control: Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!