Quantifying APOBEC3B mRNA Expression

Real-time polymerase chain reaction (PCR) was performed to confirm the expression of APOBEC3B messenger RNA (mRNA) in the cell lines. RNA was extracted from each cell using an RNA-spin^TM Total RNA Extraction Kit (iNtRON Biotechnology, Seoul, Republic of Korea). The extracted RNA was quantified using a NanoDrop^TM Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and 2 µg of complementary DNA (cDNA) was subsequently synthesized using an AMPEGENE^® cDNA Synthesis Kit (Enzo Life Sciences, Farmingdale, NY, USA). Real-time PCR was performed using DNA Master SYBR Green I and Light Cycler 2.0 real-time PCR equipment (Roche, Basel, Switzerland). The primers used for human APOBEC3B were GACCCTTTGGTCCTTCGAC (sense) and GCACAGCCCCAGGAGAAG (antisense). The primers for human β-actin were GTCCACCTTCCAGCAGATGT (sense) and AAAGCCATGCCAATCTCATC (antisense). The detailed experiments were performed as previously described [21 (link)].