Peripheral blood mononuclear cells were isolated from blood samples after Pancoll fractionation (PAN Biotech). CD34+ cells were then isolated by a magnetic sorting system (Miltenyi Biotec CD34 Progenitor cell isolation kit) following the supplier protocol. CD34+ cells were placed in an in vitro two-phase liquid culture system, as previously described.10 (link) For detailed protocols please refer to the Online Supplementary Appendix.
For cultures treated with pomalidomide, cells were incubated with 1 mM pomalidomide (Sigma) as previously described,11 (link) starting from day 1 (D1) of phase II of culture. For γ-globin derepression experiments using CRISPR/Cas9, patient CD34+ cells were immunoselected and cultured for 48 hours (h) and then electroporated with ribonucleoprotein (RNP) complexes containing Cas9-GFP protein (4.5 mM) and the -197 guide RNA (gRNA) targeting both HBG1 and HBG2 γ-globin promoters (5’ ATTGAGATAGTGTGGGGAAGGGG 3’; protospacer adjacent motif in bold) or a gRNA targeting the Adeno-associated virus integration site 1 (AAVS1; 5’ GGGGCCACTAGGGACAGGATTGG 3’; protospacer adjacent motif in bold).12 (link) Cleavage efficiency was evaluated in cells harvested 6 days after electroporation by Sanger sequencing followed by tracking of indels by decomposition (TIDE) analysis.13 (link)
For cultures treated with pomalidomide, cells were incubated with 1 mM pomalidomide (Sigma) as previously described,11 (link) starting from day 1 (D1) of phase II of culture. For γ-globin derepression experiments using CRISPR/Cas9, patient CD34+ cells were immunoselected and cultured for 48 hours (h) and then electroporated with ribonucleoprotein (RNP) complexes containing Cas9-GFP protein (4.5 mM) and the -197 guide RNA (gRNA) targeting both HBG1 and HBG2 γ-globin promoters (5’ ATTGAGATAGTGTGGGGAAGGGG 3’; protospacer adjacent motif in bold) or a gRNA targeting the Adeno-associated virus integration site 1 (AAVS1; 5’ GGGGCCACTAGGGACAGGATTGG 3’; protospacer adjacent motif in bold).12 (link) Cleavage efficiency was evaluated in cells harvested 6 days after electroporation by Sanger sequencing followed by tracking of indels by decomposition (TIDE) analysis.13 (link)
