Polymerase chain reaction (PCR) was performed on the synthesized cDNA with two pairs of primers PPRVF1b: [ 5′AGTACAAAAGATTGCTGATCACAGT 3′]
PPRVF2d: 5′GGGTCTCGAAGGCTAGGCCCGAATA 3′ and NP3 (5′-TCTCGGAAATCGCCTCACAGACTG-3′) and NP4 (5′-CCTCCTCCTGGTCCTCCAG AATCT-3′) which target 448 and 351 bp fragments, respectively, as previously described (13 (link), 14 (link)).
The PCR reaction was performed in a 20 μl reaction containing 10 μl Taq DNA Pol 2.0X MyTaqRedMix (Bioline, UK), 1 μl (10 μM) of each primer, 3 μl of cDNA and 5 μl of nuclease-free water (Qiagen, USA). The mixture was then subjected to an initial denaturation at 95°C for 5 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 2 min and final extension at 72°C for 7 min. Amplification was performed in a S1000 ™ Thermal Cycler [BIO RAD, California, United states]. Ten microliter of each PCR amplicon were resolved on a 2% ethidium bromide-stained agarose gel as previously described (14 (link)–16 ).
Free full text: Click here