Generation and Characterization of Anti-C5 scFv-Fc Variants

Anti C5 scFv antibody (6 (link)) was cloned, using BssH2 and NheI restriction sites, into pMB-SV5 vector (16 (link)) containing human IgG1 Fc region to produce the scFv-Fc molecule called Mubodina (ADIENNE Pharma & Biotech). Ergidina was generated by replacing SV5 tag with the peptide RGD-4C (17 (link)). To this end, Mubodina was amplified with the following oligos pMBsense CTGCTTACTGGCTTATCG and pMB-RGD-anti GGTTTAAGCTTTTAGCCGCAGAAACAATCTCCTCGGCAGTCGCAGGCGCCTTTACCCGGGGACAGGGAGAG. The first oligo anneals on the vector pMB at the 5′ while the second anneals at the end of human CH3 region and introduce the RGD-4C sequence and the Hind III restriction site sequence. After PCR amplification, the fragments were cut with XbaI an Hind III restriction sites and cloned into pMB-SV5 vector. Finally, both Moubodina and Ergidina were subcloned into pUCOE (18 (link)) vector. All clones obtained were confirmed by sequencing.
Purified plasmid DNA was transfected with freestyle max reagent (Invitrogen) in CHO-S cells according to a standard protocol and the cells were grown in Pro-CHO 5 (Lonza). The recombinant scFv-Fcs were purified from cell-conditioned medium loaded on Protein A column and eluted with citric acid 0.1M pH 3. Fractions containing the recombinant proteins were selected by ELISA (6 (link)) and checked for purity by SDS-PAGE (19 (link)).