Primary human umbilical vein endothelial cells (HUVEC) were isolated from umbilical cords obtained from local hospitals under the University of California, Irvine, Institutional Review Board approval and were cultured as previously described [4 (link)]. Normal human lung fibroblasts (NHLFs) were purchased from Lonza and cultured in M199 containing 10% FBS. Human cardiac microvascular endothelial cells (HMVECs) were purchased from Lonza and maintained similarly to HUVEC. The BALB/c colon carcinoma cell line CT26.WT (ATCC) was cultured in RPMI (Life Technologies) supplemented with 10% fetal bovine serum.
HUVEC were transfected with siRNA using Lipofectamine 2000 in Opti-MEM (Invitrogen). The sequences of the siRNA to human raptor and Rictor (Thermo Scientific) are as follows: Raptor 5′GGGAGAAGCUGGAUUAUUUUU3′ and Rictor 5′GGAAAUAAGGCGAGGUCUAUU3′. siRNA targeting Rheb and Sin1 were ON-TARGETplus siRNA from Thermo Scientific. A non-targeting scrambled control siRNA (Thermo Scientific) was used in all experiments to assess sequence independent effects of siRNA delivery. Transfection efficiency was determined by Western blot (see below).
HUVEC were transfected with siRNA using Lipofectamine 2000 in Opti-MEM (Invitrogen). The sequences of the siRNA to human raptor and Rictor (Thermo Scientific) are as follows: Raptor 5′GGGAGAAGCUGGAUUAUUUUU3′ and Rictor 5′GGAAAUAAGGCGAGGUCUAUU3′. siRNA targeting Rheb and Sin1 were ON-TARGETplus siRNA from Thermo Scientific. A non-targeting scrambled control siRNA (Thermo Scientific) was used in all experiments to assess sequence independent effects of siRNA delivery. Transfection efficiency was determined by Western blot (see below).
