After hybridization, cells were washed four times in 2× SSCT at 60°C and rinsed in 1× PBS for 1 min. Cells then incubated with 1 μM Atto 550–labeled imager in PBS and washed twice in 1× PBS. The cells were blocked with 2% bovine serum albumin and 10% goat serum in PBS. Then stained with anti-GFP antibody (1:200 dilution; Abcam, Ab290) 3 hours at room temperature. After washing three times with phosphate-buffered saline with 0.1% Tween 20 (PBST), the cells incubated with Alexa Fluor 488–conjugated secondary antibodies (1:200 dilution; Cell Signaling Technology, #4412) at room temperature for 1 hour. The telomere probe sequence is ACATCATCATGGGCCTTTTGGCCCATGATGATGTATGATGATG/3InvdT/, and the Imager sequence is ATGATGATGTATGATGATGT.
Telomere DNA FISH Assay in HeLa Cells
After hybridization, cells were washed four times in 2× SSCT at 60°C and rinsed in 1× PBS for 1 min. Cells then incubated with 1 μM Atto 550–labeled imager in PBS and washed twice in 1× PBS. The cells were blocked with 2% bovine serum albumin and 10% goat serum in PBS. Then stained with anti-GFP antibody (1:200 dilution; Abcam, Ab290) 3 hours at room temperature. After washing three times with phosphate-buffered saline with 0.1% Tween 20 (PBST), the cells incubated with Alexa Fluor 488–conjugated secondary antibodies (1:200 dilution; Cell Signaling Technology, #4412) at room temperature for 1 hour. The telomere probe sequence is ACATCATCATGGGCCTTTTGGCCCATGATGATGTATGATGATG/3InvdT/, and the Imager sequence is ATGATGATGTATGATGATGT.
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization : University of California, San Francisco
Variable analysis
- Transfection of ATM-SPARK plasmid
- Telomere DNA FISH
- Localization of GFP-tagged proteins
- Hela cells grown on eight-well chambered slide
- Paraformaldehyde fixation
- Permeabilization with Triton X-100
- Acid treatment with HCl
- Hybridization conditions (temperature, concentration of reagents)
- Washing conditions
- Antibody staining conditions
- Positive control: Not mentioned
- Negative control: Not mentioned
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!