Generating shRNA Plasmids for RNASET2 Knockdown

To construct shRNA plasmids, the shRNA oligo for shRNASET2 (forward sequence 5′‐GCAAGAGAAAUUCACAAACUGCAGC‐3′ and reverse sequence 5′‐GCUGCAGUUUGUGAAUUUCUCUUGCUU‐3′) and control shRNA (forward sequence 5′‐CUUCCUCUCUUUCUCUCCCUUGUGA‐3′ and reverse sequence 5′‐UCACAAGGGAGAGAAAGAGAGGAAGGA‐3′) [28 (link)] were cloned into the pGPU6/GFP/Neo vector (GenePharma, Shanghai, China) according to the manufacturer's instruction. ccRCC cell line 786‐O cells or 769‐P cells were transfected with RNASET2 shRNA plasmids or control shRNA plasmids using HighGene transfection reagent (Abclonal, Wuhan, China) and selected for 2 weeks in 500 μg·mL⁻¹ Geneticin (G418; Selleck, Houston, TX, USA). Subsequently, the selected cells were cultured in 200 μg·mL⁻¹ G418.