The UniProt ID for GbpA from A. veronii strain HM21 is: A0A7Z3TUS8 and the UniProt ID for GbpA from V. cholerae strain ATCC 39315 is: Q9KLD5. To generate a plasmid for the expression of unmodified A. veronii GbpA, PCR product of the gbpA ORF inclusive of the stop codon was generated by using the primers CBPf (gcatcatatggcagcaaaaatccatc)/CBPr1 (gcatctcgagtcacttcagctcaatccaggctt). The PCR product was cloned into the NdeI and XhoI sites of plasmid pET21b (Novagen). To generate a plasmid for the expression of a cleavable GST tagged GbpA, PCR product of the gbpA ORF lacking the secretion signal and inclusive of the stop codon were generated by using the primers GSTCBPf (gcatgaattccacggctacatcagccagccc)/GSTCBPr (gcatctcgagtcatcacttcagctcaatccagg) and cloned into the EcoR1 and Xho1 sites of pGEX6p1. The plasmids were then transformed into E. coli BL21 (DE3) RIL-CodonPlus cells (Stratagene).
Protein purification was achieved using a glutathione Sepharose 4B column (GE Healthcare) following the recommended protocol. Glutathione S-transferase (GST) cleavage was achieved after elution of GbpA from the column by adding 1 unit of PreScission protease enzyme and incubation overnight at 4°C per the instructions of the manufacturer (GE Healthcare).
Protein purification was achieved using a glutathione Sepharose 4B column (GE Healthcare) following the recommended protocol. Glutathione S-transferase (GST) cleavage was achieved after elution of GbpA from the column by adding 1 unit of PreScission protease enzyme and incubation overnight at 4°C per the instructions of the manufacturer (GE Healthcare).
