16S rRNA gene sequencing and species identification

Genomic DNA was extracted as previously described [57 (link)]. Amplification of the full-length 16S rRNA gene was performed by polymerase chain reaction (PCR) with universal primers 27F (5′-GAGTTTGATCCTGGCTCAG) and 1525R (5′–AGAAAGGAGGTGATCCAGCC) [58 (link)]. PCR reactions were carried out with Supreme NZYTaq DNA polymerase (NZYTech, Portugal) with 30 cycles of 1 min at 94 °C, 1 min at 55 °C, and 1 min at 72 °C. Products were purified using JET Quick PCR Purification Spin Kit (Genomed GmbH, Germany) according to manufacturer’s instructions and sequenced at GATC Biotech (Germany). 16S rRNA gene sequences were compared with sequences at the NCBI database using the BLAST tool (http://blast.ncbi.nlm.nih.gov/) and assignment to species level considered nucleotide sequence identities of ≥99%. For species identity validation, DNA from Mycobacterium isolates was used for PCR amplification of partial sequences of rpoB and hsp65 genes with mycobacterial-specific primers GrpoB1 (5′-ATCGACCACTTCGGCAACCGCC), GrpoB2 (5′-GGTACGGCGTCTCGATGAASCCG), and Tb11 (5′-ACCACGATGGTGTGTCCAT), Tb12 (5′-CTTGTCGAACCGCATACCCT), respectively [59 (link)]. PCR reactions were carried out with KOD Hot-Start DNA polymerase (Novagen) according to manufacturer’s instructions and PCR products were purified and sequenced, as described above.