HOXA3 expression in NSCLC samples was detected by RT-qPCR which was performed as previously described (20 (link)–22 (link)). Total RNA was extracted from the tumour and cancer-adjacent normal tissues using the RNeasy reagent (Qiagen, Shanghai, China). The RNA concentration was measured using NanoDrop2000 (Thermo Fisher Scientific, Wilmington, DE, USA). Total RNA was reverse transcribed (10 µl reaction system) using a reverse transcription kit (ABI, Life Technologies, Carlsbad, CA, USA) to obtain cDNA for RT-qPCR. SYBR-Green (Shanghai GeneCore BioTechnologies Co., Ltd., Shanghai, China) was used to perform RT-qPCR and the distinctiveness of the PCR product was differentiated based on melting curve (23 (link)–26 (link)). RT-qPCR was carried out using the following conditions: preheating for 10 min at temprature 95°C; and then repeating 40 cycles in temperature 95°C for 15 sec and 60 sec at 60°C. The primer sequences of HOXA3 were as follows: Upstream, TCATTTAAGAGCGCCTGGACA and downstream primer, GAGCTGTCGTAGTAGGTCGC. Using GAPDH as an internal reference gene and the primer sequence were as follows: Upstream, 5′-TGGTCCCTGCTCCTCTAAC-3′, downstream primer, 5′-GGCTCAATGGCGTACTCTC-3′. The relative expression level of HOXA3 in this study was calculated using the 2−ΔΔCq (27 (link)) formula (28 (link), 29 (link)).