qRT-PCR Analysis of TGFβ1-Induced Transcripts

qRT-PCR experiments were performed as previously described35 (link)36 (link). Cells were seeded onto 6-well plates, serum starved for 16 h prior to TGFβ1 (50 pM) treatment. cDNA was made from 1 µg of the isolated RNA using the I-Script cDNA kit (BioRad) according to the manufacturer’s protocol. qRT-PCR reactions were performed in quadruplicate according to the manufacturer’s protocol in a CFX 384 Real time System qRT-PCR machine (BioRad). Each reaction included cDNA (2.5% of reverse transcriptase reaction) with forward and reverse primers (0.5 μM each) and 50% SYBR Green (BioRad). All primers were designed using PerlPrimer® and purchased from Invitrogen. Primers used are as follows (5′-3′): PAI-1 forward: AGCTCCTTGTACAGATGCCG, reverse: ACAACAGGAGGAGAAACCCA, GAPDH forward: TGCACCACCAACTGCTTAGC, reverse: GGCATGGACTGTGGTCATGAG, RPL13A forward: CCTGGAGGAGAAGAGGAAAGAGA, reverse: TTGAGGACCTCTGTGTATTTGTCAA. The primer efficiency was determined and taken into account when evaluating the qRT-PCR data. The data was normalised to the geometrical mean of two housekeeping genes (GAPDH and RPLI3A) and the Pfaffl method37 (link) was used to analyse the qRT-PCR data.