Generation of POLH-KO HEK293 Cell Line

The CRISPR/Cas9-mediated POLH-KO HEK293 cell line was generated as described previously [32 (link)]. The guide RNA (5′−CACCGGGATCGAGTGGTTGCTCTCG−3′) targeting the exon 1 was designed using the CRISPR design tool (http://crispr.mit.edu (accessed on 5 October 2018)). Cells were transduced with gRNA-encoding lentiviruses generated from LentiCRISPRV2 (Addgene #52961). Infected cells were selected using puromycin (2 μg mL⁻¹), and single cell clones were obtained through limited dilution in 96-well plates. The POLH knockout was confirmed by immunoblotting and genomic sequencing from candidate clones. Cell lysate preparation and immunoblotting was performed as described in [18 (link)], using anti-pol η (A301-231A, Bethyl Laboratories, Montgomery, TX, USA), anti-β-actin (GTX629630, Genetex, Irvine, CA, USA), anti-mouse IgG (GTX213111-01, Genetex), and anti-rabbit IgG (GTX213110-01, Genetex) antibodies.