Cultured calli were harvested and promptly transferred to liquid nitrogen for enhanced RNA isolation before being stored at −80 °C until RNA extraction. The RNA extraction utilized the RNeasy Plant Mini Kit (Qiagen), followed by mRNA quantification using a DeNovix Spectrophotometer (DeNovix Inc., Wilmington, NC, USA). Subsequent steps involved synthesizing complementary DNA (cDNA) with the ReverTra AceTM qPCR RT Master Mix (Toyobo, Tsuruga, Japan) as per the manufacturer’s protocol. For quantitative real-time RT-PCR (qRT-RT-PCR), the reaction mixtures comprised 10 μL of THUNDERBIRDTM Next SYBR® qPCR Mix (Toyobo), 1 μL each of forward and reverse primers (10 pmol/μL and 10 pmol/mL, respectively), 7 μL of Nuclease-Free Water, and 1 μL of cDNA in a PCR plate. Amplification utilized the Rotor-Gene Q 6plex System (Rotor-Gene Q, Qiagen) involving 40 cycles: denaturation at 95 °C for 15 s, annealing at 62 °C for 1 min, and extension at 72 °C for 1 min. Each plate contained a minimum of three replications. Normalization of target gene expression was performed against the endogenous control gene (RhEF1) using the previously mentioned forward primer GGGTAAGGAGAAGGTTCACATC and reverse primer CAGCCTCCTTCTCAAACCTCT [22 (link)]. Relative expressions were calculated using the formula R = 2−[ΔCt sample − ΔCt control].
Free full text: Click here
