Wheat Small RNA Sequencing and Analysis

Small RNA library sequences [21 (link)] were downloaded from GEO Omnibus using accession codes from GSM1306034 to GSM1306049. This library has a collection of 16 sets of RNA sequences; each dataset contained the reads from a group of three individuals of a wheat cultivar (i.e., Mace or Arapahoe), either healthy (control) or infected with virus (i.e., TriMV or WSMV, or double-infection with both viruses), at a specific temperature (i.e., 18 °C or 27 °C). First, the FastQC [40 ] tool was used to ensure each sequence set had a good “per base quality” score, and we found that all reads had Phred quality score > 30. Next, we employed the Cutadapt [41 (link)] tool to remove the residual Illumina TruSeq sequencing adapters using the sequence “TGGAATTCTCGGGTGCCAAGG” with an error rate of 0.1. Finally, the Cutadapt tool was used once more to trim down the reads to a range of 18–36 base pairs, which is a range reasonable for miRNA (21-25 bp) detection while also being computationally less challenging. The resulting datasets were used as query input for alignment against the mature miRNA database.