CRISPR-Cas9 constructs targeting cyclin A (CAGTATGAGAGCTATCCTCG) or CDC25A (AAGAGCAGGCGGCGGCGGTG) were prepared by ligating the annealing products of 5′-CACCGCAGTATGAGAGCTATCCTCG-3′ and 5′-AAACCGAGGATAGCTCTCATACTGC-3′ or 5′-CACCGAAGAGCAGGCGGCGGCGGTG-3′ and 5′-AAACCACCGCCGCCGCCTGCTCTTC-3′, respectively, to BbsI-cut pX330 (a gift from Feng Zhang; obtained from Addgene; Addgene#42230). CDK2 CRISPR-Cas9 in pX330 was generated as previously described (25 (link)).
FLAG-3C-cyclin A in pCDNA3.1(−) was generated as previously described (61 (link)). CRISPR-resistant silent mutations were introduced into cyclin A with a double PCR procedure. In the first PCR, FLAG-cyclin A in pUHD-P3 (62 (link)) was used as a template and amplified with 5′-AGCTCGTTTAGTGAACCGTCAGATCG-3′ and 5′-GCCATATTGGTAGACTGGTTAGTTG-3′ and 5′-GTCTACCAATATGGCTCTCATACTG-3′ and 5′-TATCTTATCATGTCTGGATCC-3′. These PCR products were then amplified in the second PCR using the franking primers (first and last primers above). AID-cyclin A constructs were generated by inserting NcoI–BamHI-cut fragment of the double PCR product into NcoI–BamHI-cut pRevTRE-AID/Hyg (25 (link)) or pUHD-SB-AID/Hyg (26 (link)).
FLAG-3C-cyclin A in pCDNA3.1(−) was generated as previously described (61 (link)). CRISPR-resistant silent mutations were introduced into cyclin A with a double PCR procedure. In the first PCR, FLAG-cyclin A in pUHD-P3 (62 (link)) was used as a template and amplified with 5′-AGCTCGTTTAGTGAACCGTCAGATCG-3′ and 5′-GCCATATTGGTAGACTGGTTAGTTG-3′ and 5′-GTCTACCAATATGGCTCTCATACTG-3′ and 5′-TATCTTATCATGTCTGGATCC-3′. These PCR products were then amplified in the second PCR using the franking primers (first and last primers above). AID-cyclin A constructs were generated by inserting NcoI–BamHI-cut fragment of the double PCR product into NcoI–BamHI-cut pRevTRE-AID/Hyg (25 (link)) or pUHD-SB-AID/Hyg (26 (link)).
Free full text: Click here
