Quantitative PCR Amplification Protocol

PCR amplification was conducted as previously described [27 (link)] in which 3–4 replicate reactions were run for each quantity of lambda gDNA, and the F_C datasets averaged to generate a single amplification profile for analysis. Briefly, replicate amplification sets consisting of 5.0 μl reactions containing lambda gDNA (New England BioLabs) at the specified quantity and 500 μM of the lambda primers K7B (CTGCTGGCCGGAACTAATGAATTTATTGGT) and K12 (ATGCCACGATGCCTCATCACTGTTG). The standard curve presented in Figure 1 employed QuantiTect (Qiagen) enzyme formulation, whereas DyNAmo (Finnzymes, distributed by New England BioLabs) was used for the standard curves containing increasing quantities of SYBR Green I (Table 1). SYBR Green I was diluted to the appropriate quantity using ddH₂0 before addition to the PCR master mix just prior to amplification reaction preparation and is expressed in units designated by the manufacturer (Invitrogen).
All amplifications were conducted with a Mx3000P spectrofluorometric thermal cycler (Stratagene) using a two temperature cycling regime initiated with a 15 min activation at 95°C, followed by 50 cycles of 120 s annealing and elongation at 65°C and a 10 s denaturation at 95°C. To increase optical precision, three fluorescent reads were taken at the end of the annealing and elongation step and the average used as an estimate of reaction fluorescence. Specificity of amplification was confirmed by melting curve analysis conducted at the end of each run.
An extensive description of the development and implementation of the LRE method is provided by Rutledge and Stewart [27 (link)]. Automated LRE analysis was conducted using the prototypic Java program provided as supplementary materials in this earlier study using default values.