Lentiviral Overexpression of FAM83A and EGFR

Plasmids encoding shRNAs targeting FAM83A or GFP in pLKO.1 were acquired from Sigma-Aldrich (Sigma Aldrich; sh83A2 TRCN0000168628, sh83A6 TRCN0000168368) [33 (link)]. FLAG-FAM83A expression construct was created using LongAMP TAQ PCR kit (New England Biosystems) (forward primer GGGCCGCCACCATGGACTACAAAGAC, reverse primer GGGCGGCCGCATCGATCCTGGGCCTGCGGA). Reactions included a final Taq extension to create A overhangs for cloning into pCR8 entry vector using pCR8/GW/TOPO TA Cloning Kit with One Shot TOP10 E. coli (Thermo Fisher Scientific). LR clonase (Thermo Fisher Scientific) was used to recombine FLAG-FAM83A into a pLenti CMV Neo Dest vector (Addgene 17392). The EGFR expression vector was created by recombining pDONR223-EGFR (Addgene 23935) with plx304 (Addgene 25890) using LR clonase.
Lentiviral vectors were transfected into HEK293T cells using Lipofectamine 2000 (Thermo Fisher Scientific) together with second generation packaging constructs pCMV-dR8.74 and pMD2G (gifts from D. Trono, University of Geneva, Geneva, Switzerland). Supernatants containing virus were collected at 24 and 48 hours and supplemented with 4 μg/ml polybrene (Santa Cruz) before being frozen in aliquots. Cells were subsequently infected with virus for 16 hours.