RASSF1 Promoter Cloning and Luciferase Assay

The genomic DNA was extracted from HFFF2 cells using DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD, USA) according to the supplied protocol. The RASSF1 promoter region (−930 to +38 relative to the transcription initiation site) was amplified by PCR using 100 ng genomic DNA, Q5 High‐Fidelity DNA polymerase (New England BioLabs, Ipswich, MA, USA), and the primers 1 (forward) (5′‐GCTGGAGCGAGAAAACAGAG) and 2 (reverse) (5′‐CAATGGAAACCTGGGTGCAG). The PCR product size was 969 base pairs. Following PCR, the generated fragment was subcloned into a pCR‐Blunt II‐TOPO vector (Invitrogen, Carlsbad, CA, USA). Then, the target fragment, co‐digested by KpnI and EcoRV (New England BioLabs), was subcloned into the KpnI and EcoRV sites of pBV‐Luc vector [52 (link)] (a gift from Bert Vogelstein; Addgene plasmid # 16539; http://n2t.net/addgene:16539; RRID: Addgene_16539), carrying a firefly luciferase coding sequence under the control of a minimal promoter. All constructs were confirmed by sequencing.