Quantifying acrB Gene Expression in Ciprofloxacin-Resistant Bacteria

To extract RNA, ciprofloxacin-resistant and intermediate strains were cultured in Nutrient broth for 24 h at 37 °C with sub-MIC concentrations of hydroalcoholic extract. Subsequently, RNA extraction was performed using Trizol (CinnaGen). Then, cDNA synthesis was performed using the Takara kit (Takara, Japan). Finally, concentration of extracted cDNA was determined by NanoDrop. qRT-PCR using a SYBR Green-containing Master Mix (Ampliqon, Denmark) was meant to evaluate the gene expression of the acrB efflux pump. Reagents in a final volume of 25 μL included 2 μL of extracted cDNA (100 ng), 10 picomoles of forward and reverse primers,, and 12.5 μL of SYBR Green-containing Master Mix. The temperature program of qPCR was 95 °C for 5 min, 95 °C for 30 sec, and 60 °C for 30 sec in 40 cycles. The 16S rRNA gene was used as internal control. Finally, the relative expression of the acrB gene was calculated by the ΔΔ_T method. Primers used in this section were acrB F 5′-TGAAGACCAGGGCGTATTCCT-3′ and acrB R 5′-TTTTTGCGTGCGCTCTTG-3′, as well as 16S rRNA F5’-CGTGTTGTGAAATGTTGGGTTAA-3’and16S rRNA R5’- CCGCTGGCAACAAAGGATAA -3 (13 (link)).