Inhibition of Fibrosis and Inflammation in Hypoxia

FG-3019 (10 mg/kg) and control IgG (10 mg/kg)—both administered intraperitoneal every week at initiation of hypoxia exposure (Wang et al., 2011 (link))—were the kind gift of FibroGen Inc. (San Francisco, CA). Bleomycin Sulfate, ML141, and dichloromethylenediphosphonic acid disodium salt (clodronate) was purchased through MilliporeSigma. Lipids and cholesterol for liposome production were bought from Avanti Polar Lipids. EBM-2 culture media (Lonza), with EGM-2 bulletkit, was utilized for all in vitro experiments. Primer sequences are as follows: CTGF forward primer GGGAGAACTGTGTACGGAGC; CTGF reverse primer AGTGCACACTCCGATCTTGC; CD11b forward primer ATGGACGCTGATGGCAATACC; CD11b reverse primer TCCCCATTCACGTCTCCCA; 18S forward primer ACCTGGTTGATCCTGCCAGTAG; and, 18S reverse primer TTAATGAGCCATTCGCAGTTTC. Antibodies used in this study were: anti-GFP (Aves), MECA-32 (BD Biosciences), CTGF (BD Biosciences), CD11b (Abcam), F4/80 (BD Biosciences), CD31 (Santa Cruz Biotechnology), and GAPDH (Abcam). Antibodies for flow cytometry used in this study were: CD45 (FITC; BioLegend), CD11b (APC-Cy7; BioLegend), and IgG2 (isotype control; BioLegend). Active Cdc42 detection kit was purchased through Cell Signaling Technology. Secondary fluorescent antibodies were from Jackson Immunoresearch. Refer to Supplementary Table 1 for full details of antibody catalog number and dilutions.