Cell lines [Tal3, TC-1 (positive control) and HEK293 (negative control)] were cultured in vitro and lysed in TRIzol. Cellular RNA was isolated using Direst-zol MicroPrep Kit (Zymogen) and cDNA was made using iScript Reverse Transcription Supermix for qRT-PCR (Bio-Rad) according to the supplied protocols. Gene transcript was amplified using the isolated RNA as a template and HPV16 E6 primers (forward, ACAAACCGTTGTGTGATTTGTT; reverse, CAGTGGCTTTTGACAGTTAATACA) with a Touchdown qPCR assay, as described previously (31 (link)). Subsequently, 1 μL of qPCR product was transferred to a 1% agarose gel with 0.01% ethidium bromide and run at 130V for 45 minutes. Resultant bands were visualized using the ChemiDoc Touch Imaging System (Bio-Rad).
Protocol detail
HPV16 E6 Gene Expression Analysis
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Agarose
Assay
Cdna
Cell lines
Cellular
Ethidium bromide
Gene
Hpv16 e6
Primers
Reverse transcription
Touch
Trizol
Zymogen
Corresponding Organization : Johns Hopkins University
Top 5 similar protocols
Variable analysis
independent variables
- Cell lines [Tal3, TC-1 (positive control) and HEK293 (negative control)]
- Expression of HPV16 E6 gene transcript
- Culture conditions (in vitro)
- Positive control: TC-1 cell line
- Negative control: HEK293 cell line
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!