Constructing pUA66 with stress promoters

To construct pUA66 with the stress promoters PrprA and PcpxP fused to the gene encoding mneongreen (mNG) [10 (link)], the promoter region of rprA and cpxP were amplified by PCR using pUC66-RprA-GFPmut (kindly provided by Tanneke den Blaauwen) and genomic DNA of the E. coli strain MG1655 as template, respectively (rprA; FW: TCGACTCGAGAATTGATATTTGCTTGCTCTTCC, RV: GCAGGATCCGAGCTAATAGTAGGCATACGGAC, cpxP; FW: CTCGAGAGACGTCGCTAATCCATGAC, RV: CGTTGAATCGCGACAGAAAGAGGATCCT). The primers were flanked by XhoI and BamHI restriction sites and the resulting PCR fragments were cloned into the XhoI/BamHI cut pUA66 already containing mNG, creating pUA66-PrprA-mNG and pUA66-PcpxP-mNG. The sequences of the plasmids were confirmed by automated DNA sequencing (Macrogen Europe).