Species identification of selected isolates was confirmed by PCR with primers based on the 16S–23S rRNA spacer region for S aureus.12 (link) Testing of strains for the presence of PBP2a was done with the Mastalex test (Mast Group, Bootle, UK), which is a slide agglutination assay that detects PBP2a in MRSA by use of latex sensitised with a monoclonal antibody directed against PBP2a.5 (link) Molecular detection of mecA, femB, and the SCCmec–orfX junction was done with PCR, as described previously.13 (link), 14 (link), 15 (link), 16 (link), 17 (link), 18 (link) A comparison of the primer sequences used to test for mecA and the target sequences in mecA and mecALGA251 are shown in the webappendix (p 2) . Isolates were genotyped for multilocus sequence type and spa type, as described previously.19 (link), 20 (link)
For all test isolates, the MIC of oxacillin and cefoxitin were measured by either Etest (AB Biodisk, Solna, Sweden) or agar dilution,21 (link) depending on which laboratory did the test. The disc diffusion technique was used to establish susceptibility of LGA251 and LGA254 to penicillin, oxacillin, cefoxitin, gentamicin, neomycin, ciprofloxacin, tetracycline, erythromycin, clindamycin, fusidic acid, chloramphenicol, teicoplanin, rifampicin, trimethoprim, linezolid, and mupirocin.22 (link) To establish whether β-lactam resistance was a result of hyperproduction of β-lactamase, tests were done with and without adjacent discs impregnated with both amoxicillin and clavulanic acid.22 (link) The S aureus NCTC 12493 strain was used as a control for MRSA and the S aureus NCTC 6571 strain was used as a control for meticillin-susceptible S aureus (both strains from the National Collection of Type Cultures, HPA, Salisbury, UK). Growth on chromogenic MRSA screening agar, MRSA ID (bioMérieux, Basingstoke, UK), was measured by standard plating and incubation for 18 h at 35°C.
We developed a PCR assay to amplify a region of mecA and the novel homologue described here, mecALGA251. Primers were based on conserved regions of the mecA sequences of previously described S aureus strains,23
S aureus LGA251, and other Staphylococcus species (Staphylococcus epidermidis, Staphylococcus sciuri, Staphylococcus vitulinus, Staphylococcus capitis, Staphylococcus kloosii, and Staphylococcus pseudintermedius). All the mecA sequences were aligned with Bioedit (Ibis Therapeutics, Carlsbad, USA). Primers were chosen from conserved regions with a GC proportion of 40%. The chosen sequences were checked with Primer3 (version 1.1.4) for melting temperatures and self-complementarity,24 and pDraw32 (version 1.1.101) was used to confirm the amplicon size and melting temperatures. Primers were as follows: Fw, 5′ TCACCAGGTTCAAC[Y]CAAAA 3′; and Rv, 5′ CCTGAATC[W]GCTAATAATATTTC 3′. Primers for the amplification of the femB control gene were obtained from a previously described protocol.13 (link) A 25 μL PCR reaction contained final concentrations of 2·5 units of Taq DNA polymerase (Qiagen, Crawley, UK); 1xQ solution (Qiagen); 1xQiagen CoralLoad PCR buffer (Tris-Cl, KCl, [NH4]2SO4, 15 mmol/L MgCl2, gel-loading reagent, orange dye, and red dye; pH 8·7; Qiagen); 4 mmol/L of MgCl2; 0·8 mmol/L of each dNTP (GeneAmp, Applied Biosystems, Warrington, UK); 0·4 μmol/L of each primer (Operon, Cologne, Germany); and 50 ng of DNA template. A negative control, with no target DNA, was included in the PCR run in the GeneAmp PCR System 9700 (Applied Biosystems). The amplification programme consisted of an initial denaturation step at 94°C for 5 min; 30 cycles of denaturing at 94°C for 1 min, annealing at 55°C for 1 min and extension at 72°C for 2 min; and a final extension at 72°C for 5 min. PCR products were analysed by electrophoresis on a 1% agarose gel, previously stained with ethidium bromide at 0·14 μg/mL (Sigma, Gillingham, UK), and run at 5 V/cm for 45 min. The molecular marker used was a 100 bp ladder (Promega, Southampton, UK). The sizes of the PCR products sequenced after PCR were 356 bp for the mecA gene, and 651 bp for the femB gene.
We designed a duplex-PCR to detect the mecA regulatory genes (primers: mecIF, 5′ GACACGTGAAGGCTATGATATAT 3′; mecIR, 5′ ATTCTTCAATATCATCTTCGGAC 3′; mecR1F, 5′ GGCTCAGTTAAATCATAAAGTTTG 3′; mecR1R, 5′ AAATTGCCTTACCATAGCTTGTGT 3′), a duplex-PCR to identify the two cassette recombinase genes (primers: ccrAF, 5′ GCAATAGGTTATCTACGTCAAAG 3′; ccrAR, 5′ TCTAATGATTGTGCGTTGATTCC 3′; ccrBF, 5′ TTCGTGTATCGACAGAAATGCAG 3′; ccrBR, 5′ CATCTTTACGAATATCAATACGG 3′), and a single target PCR to amplify the β-lactamase gene blaZ (primers: blaZF, 5′ AGTCGTGTTAGCGTTGATATTAA 3′; blaZR, 5′ CAATTTCAGCAACCTCACTTACTA 3′). The sizes of the expected PCR products were 344 bp for mecI, 710 bp for mecR1, 932 bp for ccrA, 1449 bp for ccrB, and 809 bp for blaZ. Except for use of an annealing temperature of 58°C instead of 55°C, we used the same method as for the other PCR assay described above.
The whole genome of the S aureus isolate LGA251 was sequenced with both capillary sequencing (on ABI 3730xl analysers; Applied Biosystems) and pyrosequencing (on 454 instruments; Life Sciences, Roche Diagnostics Corporation, Branford, CT, USA). A total of 29 300 high quality capillary reads were produced mostly from two subclone libraries (a 2–3 kb insert library and a 3–4 kb library, both with the vector pOTW12). The average read length was 650 bp and these reads represented 6·8 times coverage. The 454 sequencing produced 59·07 Mb data in reads with an average length of 225 bp. The assembly of these reads with Newbler 1.1.03.24 gave 81 contigs greater than 500 bp with a combined length of 2 699 627 bp in six scaffolds.
A combined assembly of the capillary reads, with Phrap (Version 17.0), and the consensus sequences from the 454 assembly (which were converted into overlapping 500 bp sequences) produced 26 contigs (overlapping sequences or clones from which a sequence can be obtained) greater than 2 kb with an N50 of 532 kb. A further 2310 high quality reads were produced to close gaps and to improve the quality of the sequence to finished standard. The sequence was finished and annotated as described previously.25 (link) The sequences and annotations of the S aureus strain LGA251 genome have been entered in the EMBL database (accession numbers FR821779 for the chromosome and FR821780 for the plasmid).
For all test isolates, the MIC of oxacillin and cefoxitin were measured by either Etest (AB Biodisk, Solna, Sweden) or agar dilution,21 (link) depending on which laboratory did the test. The disc diffusion technique was used to establish susceptibility of LGA251 and LGA254 to penicillin, oxacillin, cefoxitin, gentamicin, neomycin, ciprofloxacin, tetracycline, erythromycin, clindamycin, fusidic acid, chloramphenicol, teicoplanin, rifampicin, trimethoprim, linezolid, and mupirocin.22 (link) To establish whether β-lactam resistance was a result of hyperproduction of β-lactamase, tests were done with and without adjacent discs impregnated with both amoxicillin and clavulanic acid.22 (link) The S aureus NCTC 12493 strain was used as a control for MRSA and the S aureus NCTC 6571 strain was used as a control for meticillin-susceptible S aureus (both strains from the National Collection of Type Cultures, HPA, Salisbury, UK). Growth on chromogenic MRSA screening agar, MRSA ID (bioMérieux, Basingstoke, UK), was measured by standard plating and incubation for 18 h at 35°C.
We developed a PCR assay to amplify a region of mecA and the novel homologue described here, mecALGA251. Primers were based on conserved regions of the mecA sequences of previously described S aureus strains,23
S aureus LGA251, and other Staphylococcus species (Staphylococcus epidermidis, Staphylococcus sciuri, Staphylococcus vitulinus, Staphylococcus capitis, Staphylococcus kloosii, and Staphylococcus pseudintermedius). All the mecA sequences were aligned with Bioedit (Ibis Therapeutics, Carlsbad, USA). Primers were chosen from conserved regions with a GC proportion of 40%. The chosen sequences were checked with Primer3 (version 1.1.4) for melting temperatures and self-complementarity,24 and pDraw32 (version 1.1.101) was used to confirm the amplicon size and melting temperatures. Primers were as follows: Fw, 5′ TCACCAGGTTCAAC[Y]CAAAA 3′; and Rv, 5′ CCTGAATC[W]GCTAATAATATTTC 3′. Primers for the amplification of the femB control gene were obtained from a previously described protocol.13 (link) A 25 μL PCR reaction contained final concentrations of 2·5 units of Taq DNA polymerase (Qiagen, Crawley, UK); 1xQ solution (Qiagen); 1xQiagen CoralLoad PCR buffer (Tris-Cl, KCl, [NH4]2SO4, 15 mmol/L MgCl2, gel-loading reagent, orange dye, and red dye; pH 8·7; Qiagen); 4 mmol/L of MgCl2; 0·8 mmol/L of each dNTP (GeneAmp, Applied Biosystems, Warrington, UK); 0·4 μmol/L of each primer (Operon, Cologne, Germany); and 50 ng of DNA template. A negative control, with no target DNA, was included in the PCR run in the GeneAmp PCR System 9700 (Applied Biosystems). The amplification programme consisted of an initial denaturation step at 94°C for 5 min; 30 cycles of denaturing at 94°C for 1 min, annealing at 55°C for 1 min and extension at 72°C for 2 min; and a final extension at 72°C for 5 min. PCR products were analysed by electrophoresis on a 1% agarose gel, previously stained with ethidium bromide at 0·14 μg/mL (Sigma, Gillingham, UK), and run at 5 V/cm for 45 min. The molecular marker used was a 100 bp ladder (Promega, Southampton, UK). The sizes of the PCR products sequenced after PCR were 356 bp for the mecA gene, and 651 bp for the femB gene.
We designed a duplex-PCR to detect the mecA regulatory genes (primers: mecIF, 5′ GACACGTGAAGGCTATGATATAT 3′; mecIR, 5′ ATTCTTCAATATCATCTTCGGAC 3′; mecR1F, 5′ GGCTCAGTTAAATCATAAAGTTTG 3′; mecR1R, 5′ AAATTGCCTTACCATAGCTTGTGT 3′), a duplex-PCR to identify the two cassette recombinase genes (primers: ccrAF, 5′ GCAATAGGTTATCTACGTCAAAG 3′; ccrAR, 5′ TCTAATGATTGTGCGTTGATTCC 3′; ccrBF, 5′ TTCGTGTATCGACAGAAATGCAG 3′; ccrBR, 5′ CATCTTTACGAATATCAATACGG 3′), and a single target PCR to amplify the β-lactamase gene blaZ (primers: blaZF, 5′ AGTCGTGTTAGCGTTGATATTAA 3′; blaZR, 5′ CAATTTCAGCAACCTCACTTACTA 3′). The sizes of the expected PCR products were 344 bp for mecI, 710 bp for mecR1, 932 bp for ccrA, 1449 bp for ccrB, and 809 bp for blaZ. Except for use of an annealing temperature of 58°C instead of 55°C, we used the same method as for the other PCR assay described above.
The whole genome of the S aureus isolate LGA251 was sequenced with both capillary sequencing (on ABI 3730xl analysers; Applied Biosystems) and pyrosequencing (on 454 instruments; Life Sciences, Roche Diagnostics Corporation, Branford, CT, USA). A total of 29 300 high quality capillary reads were produced mostly from two subclone libraries (a 2–3 kb insert library and a 3–4 kb library, both with the vector pOTW12). The average read length was 650 bp and these reads represented 6·8 times coverage. The 454 sequencing produced 59·07 Mb data in reads with an average length of 225 bp. The assembly of these reads with Newbler 1.1.03.24 gave 81 contigs greater than 500 bp with a combined length of 2 699 627 bp in six scaffolds.
A combined assembly of the capillary reads, with Phrap (Version 17.0), and the consensus sequences from the 454 assembly (which were converted into overlapping 500 bp sequences) produced 26 contigs (overlapping sequences or clones from which a sequence can be obtained) greater than 2 kb with an N50 of 532 kb. A further 2310 high quality reads were produced to close gaps and to improve the quality of the sequence to finished standard. The sequence was finished and annotated as described previously.25 (link) The sequences and annotations of the S aureus strain LGA251 genome have been entered in the EMBL database (accession numbers FR821779 for the chromosome and FR821780 for the plasmid).
Free full text: Click here
