Generation of XPC-GFP and GFP-DDB2 cell lines

To generate DLD-1 and HCT116 XPC KO cells transiently expressing XPC-GFP, cells were transfected with an XPC-GFP cDNA construct (pLenti-CMV-Puro-DEST; (43 (link))) using jetPEI® transfection reagent (Polyplus) following the producer's protocol. To generate GFP-DDB2 HCT116 KI cells, cells were transfected with pLentiCRISPR-v2 carrying an sgRNA targeting the start codon of the DDB2 locus (target sequence CCTTCACACGGAGGACGCGA), and a DNA construct of GFP flanked by 60 bp sequences homologous to the DDB2 locus. After selection with puromycin and FACS for GFP-positive cells, a clonal cell line was isolated and verified by sequencing and functional analysis.