Quantifying Gene Expression with qPCR

To quantify specific transcripts, commercially available Taqman real-time quantitative PCR (qPCR) assays (Thermo Fisher Scientific) were used to measure genes of interest and housekeeping genes (Supplementary Table S2). We also used proprietary Taqman qPCR assays targeting the WT^{29 (link)} and zQ175 knockin Htt alleles separately. For the knockin allele, the forward primer was GCCCGGCTGTGGCTGA, the reverse primer was TTCACACGGTCTTTCTTGGTGG and the ZEN probe was TGCACCGACCAAAGAAGGAACTCT (Integrated DNA Technologies). cDNA was diluted 1:50 nuclease-free water (Sigma) and plated in 96-well thin wall Hard-Shell PCR plates (BioRad). Each 15 μL reaction per sample contained 1 × Taqman Fast Advanced Mastermix (Thermo Fisher Scientific), 1 × Taqman Gene expression assays and 3 μL of diluted cDNA (1:50 in nuclease-free water) and was aliquoted into the 96-well plates and sealed. Plates were centrifuged at 8 × 10³ g for 30 s and then analysed using a BioRad CFX96 thermal cycler with the following program: 95 °C for 40 s, followed by 40 cycles of 95 °C for 7 s, 60 °C for 20 s. All biological replicates were run in triplicate. C_q values deviating by ± 0.25 from the mean of the triplicate were removed from the analysis. Data for genes of interest were normalised to reference genes (CanX, Ubc and Atp5b) as per the 2^-ΔΔCt2 method^{36 (link)}.