For the microscopy in Figs 2 and 3 , yeast strains were derivatives of SEY6210a (MATa ura3-52 leu2-3, 112 his3-Δ100 trp1-Δ901 lys2-801 suc2-Δ9), obtained as a kind gift from Dr. Derek Prosser. For all other studies, yeast strain BY4742 (MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0) was used. In order to create yeast strains that activate GAL1 promoters via the addition of β-estradiol, strains were transformed with linearized pAGL (a gift from Dr. Daniel Gottschling, University of Washington), which introduces the gene encoding for the Gal4-estrogen receptor-VP16 (GEV) chimeric protein into the leu2Δ0 locus [46 (link)]. S288C yeast strains expressing either Abp1p-RFP or Abp140-3xGFP were a kind gift from Dr. Bruce Goode (Brandeis University).
To create the wBm0076-mRuby2 expressing pYES2NTA plasmid, the yomRuby2 gene was amplified from the plasmid pFA6a-link-yomRuby2-SpHis5 [87 (link)] using primers 5’- AGCTTTTCTTATAAAACAATTGATGGTGTCCAAAGGAGAGGAG and 5’- AGGGATAGGCTTAGCTGCAATTTACTTATACAATTCATCCATA, containing homology to both the C-terminus of the wBm0076 gene and the pYES2NTA-wBm0076 vector. BY4742-pAGL was co-transformed with pYES2NTA-wBm0076, previously digested with PmeI, and the mRuby2 amplicon and were plated to CSM-uracil to select for gap-repaired plasmids. Transformants were screened for red fluorescence via microscopy.
All plasmid clones were purified and sequenced for confirmation (Eton Bioscience Inc.)
To create the wBm0076-mRuby2 expressing pYES2NTA plasmid, the yomRuby2 gene was amplified from the plasmid pFA6a-link-yomRuby2-SpHis5 [87 (link)] using primers 5’- AGCTTTTCTTATAAAACAATTGATGGTGTCCAAAGGAGAGGAG and 5’- AGGGATAGGCTTAGCTGCAATTTACTTATACAATTCATCCATA, containing homology to both the C-terminus of the wBm0076 gene and the pYES2NTA-wBm0076 vector. BY4742-pAGL was co-transformed with pYES2NTA-wBm0076, previously digested with PmeI, and the mRuby2 amplicon and were plated to CSM-uracil to select for gap-repaired plasmids. Transformants were screened for red fluorescence via microscopy.
All plasmid clones were purified and sequenced for confirmation (Eton Bioscience Inc.)
Free full text: Click here
